0

I have a JSON that looks like this

{
   "barcodes": {
        "0004F--0004R": {
            "Barcode UID": "4",
            "Sample ID": "10887581",
            "For Barcode Name": "0004F",
            "For Barcode Sequence": "GGTAGTGTGTATCAGTACATG",
            "Rev Barcode Name": "0004R",
            "Rev Barcode Sequence": "GGTAGTGTGTATCAGTACATG",
            "Genes Sequenced": "",
            "Ethnicity": "",
            "laa_params": {
                "--minLength": "3000",
                "--ignoreEnds": "60",
                "--maxReads": "2500",
                "--maxPhasingReads": "500"
            }
        },
        "0014F--0014R": {
            "Barcode UID": "14",
            "Sample ID": "10895675",
            "For Barcode Name": "0014F",
            "For Barcode Sequence": "GGTAGCGTCTATATACGTATA",
            "Rev Barcode Name": "0014R",
            "Rev Barcode Sequence": "GGTAGCGTCTATATACGTATA",
            "Genes Sequenced": "A/B/C",
            "Ethnicity": "British/Irish",
            "laa_params": {
                "--minLength": "3000",
                "--ignoreEnds": "60",
                "--maxReads": "2500",
                "--maxPhasingReads": "500"
            }
        },
        "0018F--0018R": {
            "Barcode UID": "18",
            "Sample ID": "10896709",
            "For Barcode Name": "0018F",
            "For Barcode Sequence": "GGTAGCATCACTACGCTAGAT",
            "Rev Barcode Name": "0018R",
            "Rev Barcode Sequence": "GGTAGCATCACTACGCTAGAT",
            "Genes Sequenced": "B/C",
            "Ethnicity": "British/Irish",
            "laa_params": {
                "--minLength": "3000",
                "--ignoreEnds": "60",
                "--maxReads": "2500",
                "--maxPhasingReads": "500"
            }
        }
   }
}

I use this JSON to create a fasta file, where I split the name of the barcode "0014F--0014R" into two halves. Each half is placed in a file, and then the relevant sequence below it like so:

>0014F
GGTAGCGTCTATATACGTATA
>0014R
GGTAGCGTCTATATACGTATA

I do this using Groovy, the code for this is:

// Load JSON
// cfg_file is the JSON 
def analysis_config = jsonSlurper.parse(cfg_file)
// Create Keyset of "barcodes"
barcodes = Channel.from(analysis_config.barcodes.keySet())
// Create fasta:
new File('barcodes.fasta').withOutputStream { out ->
    analysis_config.barcodes.each { barcode -> 
        def (fname, revname) = barcode.key.split('--')
        out << ">$fname\n${barcode.value['For Barcode Sequence']}\n"
        out << ">$revname\n${barcode.value['Rev Barcode Sequence']}\n"
            }
}

I want to change this logic so that if "genes sequenced" is empty, skip that barcode.

In "0004F--0004R", there are no genes sequenced. How can I implement this logic?

In Python, you could simply do:

if not barcode['genessequenced']:
    continue

... and it would skip that barcode. I'm essentially a Python programmer and am using Nextflow which uses Groovy as it's base language. Help would be greatly appreciated.

NOTE

I have a feeling like my entire logic would have to change. The flow currently is:

  1. Create keySet() of all barcodes
  2. Populate each with sequences

And the flow should now be: 1. Create keySet() of barcodes with "genes sequenced" 2. Populate each with sequences

So, barcodes = Channel.from(analysis_config.barcodes.keySet()) any idea how I could add that logic into this?

Something like: 

barcodes = Channel.from(analysis_config.barcodes.[if "Genes Sequenced"].keySet())
4

1 回答 1

1

在 groovy 中有一个findAll{...}方法：

analysis_config.barcodes.findAll{b-> b.value."Genes Sequenced"}.keySet()

或者

analysis_config.barcodes.findAll{k,v-> v."Genes Sequenced"}.keySet()

或者

analysis_config.barcodes.findAll{k,v-> v["Genes Sequenced"]}.keySet()
于 2020-02-24T16:17:22.293 回答